Chat with us, powered by LiveChat For the gene annotation assignment, you will be assigned unknown DNA sequence that you will have to identify and annotate b | WriteDen

For the gene annotation assignment, you will be assigned unknown DNA sequence that you will have to identify and annotate b

 

For the gene annotation assignment, you will be assigned unknown DNA sequence that you will have to identify and annotate by completing the following task.

Must include screenshots at each step

  • Identify the open reading frame (ORF). Must describe the frame strand, positive or negative, frame 1, 2 or 3, what it means,
  • List the top three hits providing statistics such as, e-value, identity score, length etc. use the top hit to describe how the query aligns with the subject including the definitions as necessary. Use screenshot to explain.
  • Coding Sequence (CDS) Coding regions. State the coordinates of the start and stop codon. Or state if the gene is protein coding or not
  • Genomic location: State the chromosome on which the gene is found and location
  • List of exons
  • What is the gene name, organism, and gene id encoded by this DNA sequence? You can use any of the genomic browsers already covered. Explain why you concluded the sequence belong to the gene you have named.

Do not cut and paste your database results to report your findings. Write two to three paragraphs reporting the information you have obtained about this gene. Imagine this is a report you will present to an employer or a group of researchers interested in this gene.

here is the sequence:

 

ATGGACGGCCCCGGGGCCAGCGCCGTGGTCGTGCGCGTCGGCATCCCGGACCTGCAGCAGACGAAGTGCC
TGCGCCTGGACCCGACCGCGCCCGTGTGGGCCGCCAAGCAGCGCGTGCTCTGCGCCCTCAACCACAGCCT
CCAGGACGCGCTCAACTATGGGCTTTTCCAGCCGCCCTCCCGGGGCCGCGCCGGCAAGTTCCTGGACGAG
GAGCGGCTCCTGCAGGACTACCCGCCTAATCTGGACACGCCCCTGCCCTACCTGGAGTTTCGATACAAGC
GGCGAGTTTATGCCCAGAACCTCATCGATGATAAGCAGTTTGCAAAGCTTCACACAAAGGCGAACCTGAA
GAAGTTCATGGACTATGTCCAGCTGCATAGCACAGACAAGGTGGCCCGCCTGCTGGACAAGGGGCTGGAC
CCCAACTTCCATGACCCTGACTCAGGAGAGTGCCCCCTGAGCCTTGCAGCCCAGCTGGACAATGCCACGG
ACCTGCTGAAGGTGCTGAAGAACGGCGGTGCCCACCTGGACTTTCGCACTCGTGATGGGCTCACTGCTGT
GCACTGTGCCACACGCCAGCGGAATGCAGCGGCATTGACGACCCTGCTGGACCTGGGGGCATCACCTGAC
TACAAGGACAGCCGCGGCTTGACACCCCTCTACCACAGCGCCCTGGGGGGTGGGGATGCCCTCTGCTGTG
AGCTGCTTCTCCACGACCATGCTCAGCTGGGGACCACCGACGAGAATGGCTGGCAGGAGATCCACCAGGC
CTGCCGCTTCGGGCACGTGCAGCACCTGGAGCACCTGCTCTTCTACGGGGCAGACATGGGGGCCCAGAAC
GCCTCAGGGAACACAGCCCTGCACATCTGTGCCCTCTACAACCAGGAGAGCTGTGCTCGTGTCCTGCTCT
TCCGTGGAGCCAACAGGGATGTGCGTAACTACAACAGCCAGACAGCCTTCCAGGTGGCCATCATCGCAGG
GAACTTTGAGCTTGCAGAGGTTATCAAGACCCACAAAGACTCGGATGTTGTACCATTCAGGGAAACTCCC
AGCTATGCGAAGCGGCGGCGACTGGCTGGCCCCAGTGGCTTGGCATCCCCTCGGCCTCTGCAGCGCTCAG
CCAGCGATATCAACCTGAAGGGGGAGGCGCAGCCGGCAGCTTCTCCTGGACCCTCGCTGAGAAGCCTCCC
CCACCAGCTGCTGCTCCAGCGGCTGCAGGAGGAGAAAGATCGTGACCGGGATGCCGACCAGGAGAGCAAC
ATCAGTGGCCCCTTAGTAGGCAGGGGCAGCCAGAGCAAGATCAGCCCGAGCGGGCCTGGCGGCCCTGGCC
CTGCGCCCGGCCCCGGCCCCGCGCCCCCCGCGCCCCCCGCGCCGCCGCCCCGGGGCCCGAAGCGGAAACT
TTACAGCGCAGTCCCCGGCCGCAAGTTCATCGCTGTGAAGGCGCACAGCCCGCAGGGCGAAGGCGAGATC
CCGCTGCACCGCGGAGAGGCCGTGAAGGTGCTCAGCATTGGGGAGGGCGGTTTCTGGGAGGGAACCGTGA
AAGGCCGCACGGGCTGGTTCCCGGCTGACTGCGTGGAGGAGGTGCAGATGAGGCAGCATGACACGAGGCC
TGAAACCCGTGAGGACCGGACAAAGCGGCTTTTTCGGCACTACACTGTGGGCTCCTACGACAGCCTCACC
TCACACAGCGATTATGTCATTGATGACAAAGTGGCCGTCCTGCAGAAACGGGACCACGAGGGCTTTGGTT
TTGTGCTCCGGGGAGCCAAAGCAGAGACCCCCATCGAGGAGTTCACGCCCACACCAGCCTTCCCAGCGCT
GCAGTATCTTGAGTCGGTGGACGTGGAGGGTGTGGCCTGGAAGGCCGGGCTTCGCACAGGAGACTTCCTC
ATTGAGGTGAATGGGGTGAACGTGGTGAAGGTTGGACACAAGCAGGTGGTAGCTCTGATCCGCCAGGGTG
GCAACCGCCTTGTCATGAAGGTTGTGTCTGTGACAAGAAAGCCGGAAGAGGATGGGGCTCGGCGCAGAGC
CCCACCGCCCCCCAAGAGGGCCCCCAGCACCACACTGACCCTGCGCTCCAAGTCCATGACAGCTGAGCTC
GAGGAACTTGCCTCCATTCGGAGAAGAAAAGGGGAGAAGCTGGACGAGATGCTGGCAGCCGCCACAGAGC
CGACGCTGAGGCCAGACATCGCAGACGCGGACTCCAGAGCCGCCACAGTCAAACAGCGGCCCACCAGTCG
GAGGATCACACCTGCTGAGATTAGTTCATTGTTTGAACGCCAGGGCCTCCCAGGCCCAGAGAAGCTGCCG
GGCTCCTTGCGGAAGGGGATTCCACGGACCAAATCTGTAGGGGAGGACGAGAAGCTGGCGTCCCTGCTGG
AAGGGCGCTTCCCGCGGAGCACGTCGATGCAAGACCCGGTGCTGCGCGAGAGTCGCGGCATCCCGCCCCC
GCCGCAGACCGCGCCGCCGCCCCCGCCCGCGCCCTACTACTTCGACTCGGGGCCGCCCCCGGCCTTCTCG
CCGCCGCCCCCGCCGGGCCGCGCCTACGACACGGTGCGCTCCAGCTTCAAGCCCGGCCTGGAGGCGCGCC
TGGGCGCGGGGGCTGCCGGCCTGTACGATCCCGGCGCGGCCCTCGGCCCGCTGCCCTACCCCGAGCGGCA
GAAGCGCGCGCGCTCCATGATCATCCTGCAGGACTCGGCGCCGGAGACGAGCGACGTCCCCCGGCCCCCG
CCCGCAGGCACCCCGCCCGAGCGCCCCAAGCGCCGGCCGCGGCCGCCCGGCCCCGACAGCCCCTATGCCA
ACCTGGGCGCCTTCAGCGCCAGCCTCTTCGCGCCGTCCAAGCCGCAGCGCCGCAAGAGCCCGCTGGTGAA
GCAGCTGCAGGTGGAGGATGCGCAGGAGCGCGCGGCCCTGGCCGTGGGCAGCCCCGGGCCCGGCGGCGGC
AGCTTCGCACGCGAGCCCTCCCCGACCCACCGTGGTCCCCGACCCGGCGGCCTCGACTACGGCGCGGGCG
ACGGCCCGGGGCTCGCGTTCGGCGGCCCGGGCCCGGCCAAGGACCGGCGGCTGGAGGAGCGGCGCCGCTC
CACTGTGTTCCTGTCCGTGGGCGCCATCGAGGGCAGCGCCCCCAGCGCGGACCTGCCATCCCTGCAGCCC
TCCCGCTCCATCGACGAGCGCCTCTTGGGCACCGGCCCCACCGCCGGCCGCGACTTGCTGCTGCCCTCCC
CGGTGTCTGCTCTGAAGCCATTGGTCAGCGGCCCGACCCTCGGGCCCTCAGGCTCCACCTTCATCCACCC
GCTCACCGGCAAACCCCTGGACCCCAGCTCACCCCTGGCCCTTGCCCTGGCTGCCCGAGAGCGGGCTCTG
GCCTCCCAGGCACCCTCCCGGTCCCCCACGCCCGTGCACAGCCCCGACGCCGACCGCCCTGGACCCCTGT
TTGTGGATGTGCAGGCCCGGGACCCAGAGCGAGGGTCCCTGGCGTCGCCAGCCTTCTCCCCGCGAAGCCC
GGCCTGGATTCCTGTGCCTGCTCGCAGGGAGGCAGAGAAGGCCCCCCGGGAGGAGCGGAAGTCACCTGAG
GACAAGAAGTCCATGATCCTCAGCGTTCTGGACACATCCCTGCAGCGGCCAGCCGGCCTCATCGTTGTGC
ATGCCACCAGCAACGGGCAGGAGCCCAGCAGGCTGGGGGCCGAAGAGGAGCGCCCGGGCACCCCGGAGTT
GGCCCCGGCCCCCATGCAGTCAGCGGCTGTGGCTGAGCCCCTGCCCAGCCCCCGGGCCCAGCCCCCTGGC
AGCACCCCGGCAGAACCTGGGCCAGGTCAGGGCAGCTCAGAGGAAGAGCCAGAGCTGGTGTTTGCTGTGA
ACCTACCACCCGCTCAGCTGTCGTCTAGCGATGAGGAGACCAGGGAGGAGCTGGCCCGGATTGGGCTGGT
GCCACCCCCAGAAGAGTTTGCCAACGGGGTCCTGCTGGCCACCCCACTCGCTGGCCCGGGCCCCTCGCCC
ACCACGGTGCCCAGCCCGGCCTCAGGGAAGCCCAGCAGTGAGCCACCCCCTGCCCCTGAGTCTGCAGCCG
ACTCCGGGGTGGAGGAGGCTGACACACGCAGCTCCAGCGACCCCCACCTGGAGACCACAAGCACCATCTC
CACGGTGTCCAGCATGTCCACCTTGAGCTCAGAGAGCGGGGAACTCACTGACACCCACACCTCCTTCGCT
GACGGACACACTTTTCTACTCGAGAAGCCACCAGTGCCTCCCAAGCCCAAGCTCAAGTCCCCGCTGGGGA
AGGGGCCGGTGACCTTCAGGGACCCGCTGCTGAAACAGTCCTCGGACAGCGAGCTTATGGCCCAGCAGCA
CCATGCCGCCTCTGCCGGGCTGGCCTCTGCCGCCGGGCCTGCCCGCCCTCGCTACCTCTTCCAGAGAAGG
TCCAAGCTATGGGGGGACCCCGTGGAGAGCCGGGGGCTCCCTGGGCCTGAAGACGACAAACCAACTGTGA
TCAGTGAACTCAGCTCCCGCCTGCAGCAGCTGAACAAAGACACGCGTTCCCTGGGGGAGGAACCAGTTGG
TGGCCTGGGCGGCCTGCTGGACCCTGTCAAGAAGTCGCCCATCGCAGCAGCTCGGCTCTTCAGCAGCCTC
GGTGAGCTGAGCTCCATTTCAGCGCAGCGCAGCCCCGGGGGCCCGGGCGGCGGGGCCTCCTACTCGGTGA
GGCCCAGCGGCCGCTACCCCGTGGCGCGACGCGCCCCGAGCCCTGTGAAGCCCGCGTCGCTGGAGCGGGT
GGAGGGGCTGGGGGCGGGCGCGGGGGGAGCAGGGCGGCCCTTCGGCCTCACGCCCCCCACCATCCTCAAG
TCGTCCAGCCTCTCCATCCCGCACGAGCCCAAGGAGGTGCGCTTCGTGGTGCGCAGCGTGAGCGCACGCA
GCCGCTCCCCCTCGCCATCGCCGCTGCCCTCGCCCGCGTCCGGCCCCGGCCCCGGCGCCCCCGGCCCGCG
CCGGCCCTTCCAGCAGAAGCCGCTGCAGCTCTGGAGCAAGTTCGACGTGGGCGACTGGCTGGAGAGCATC
CACCTGGGCGAGCACCGTGACCGCTTCGAGGACCATGAGATCGAAGGCGCGCACCTCCCCGCGCTCACCA
AGGACGACTTCGTGGAGCTGGGCGTCACGCGCGTGGGCCACCGCATGAACATCGAGCGCGCGCTCAGGCA
GCTGGACGGCAGCTGA

    HOW OUR WEBSITE WORKS

    Our website has a team of professional writers who can help you write any of your homework. They will write your papers from scratch. We also have a team of editors just to make sure all papers are of 
    HIGH QUALITY & PLAGIARISM FREE.

    Step 1

    To make an Order you only need to click ORDER NOW and we will direct you to our Order Page at WriteDen. Then fill Our Order Form with all your assignment instructions. Select your deadline and pay for your paper. You will get it few hours before your set deadline.
     Deadline range from 6 hours to 30 days.

    Step 2

    Once done with writing your paper we will upload it to your account on our website and also forward a copy to your email.

    Step 3
    Upon receiving your paper, review it and if any changes are needed contact us immediately. We offer unlimited revisions at no extra cost.

    Is it Safe to use our services?
    We never resell papers on this site. Meaning after your purchase you will get an original copy of your assignment and you have all the rights to use the paper.

    Discounts

    Our price ranges from $8-$14 per page. If you are short of Budget, contact our Live Support for a Discount Code. All new clients are eligible for 20% off in their first Order. Our payment method is safe and secure.

    Please note we do not have prewritten answers. We need some time to prepare a perfect essay for you.